Illumina Technology

• Illumina Adapter Sequences: a comprehensive list of all Illumina adapters and indices sequences from various products (including nextera, truseq, etc.)
• Standard Index oligos:
  • P7: 5’ CAAGCAGAAGACGGCATACGAGAT[index][adapter_sequence]3’
  • P5: 5′ AATGATACGGCGACCACCGA[dual_index][adapter_sequence] 3′

Nextseq and Novaseq – 2 dye

• Rather than a separate dye for each base, 2-channel SBS uses a mix of dyes. Images are taken of each DNA cluster using red and green wavelength filter bands.
• Clusters seen in red or green images are interpreted as C and T bases, respectively. Clusters observed in both red and green images are flagged as A bases (appearing as yellow clusters), while unlabeled clusters are identified as G bases).

• Miseq – 4 dyes/2 lasers
  • G/T share one laser and C/A share another. When choosing indexes, make sure each base has diversity between the two lasers.

• iSeq
  • One dye and two chemistry step